To see the survey results, click here or read my latest blog on addgene.
PS: If you did not take part in the survey and wish to go through the survey, please follow this link for survey page.
blog about genome-editing using CRISPR-Cas9 and NgAgo system
For the first time, people outside scientific community are actually curious about snipping DNA using CRISPR-Cas9 technology. You must be wondering why on earth is everyone talking about CRISPR-Cas9 technology.
The reason everyone is excited about CRISPR-Cas9 is that the snipping of DNA can (potentially) do lots of things:
and the list is endless.
But how can CRISPR-Cas9 do so many amazing things ?
The answer lies in the ability of CRISPR-Cas9 technology to change the DNA sequence.
Our body is made up of trillions of tiny building blocks called ‘cells’. Each of these cells contain DNA molecules which decide the identity and health of each cell (and the organism). The DNA molecule is defined on the basis of how the four letters A, G, C, and T are arranged. Our DNA is approximately 3.2 billion-letters long, and if you could slice out some part of the human DNA and read the sequence, it might look something like this:
GCGTCCGAGGTAGACGATGG
Humans are humans because we have different DNA sequence than monkeys, plants, pigs, or ostrich. When I say different DNA, what I mean is that if you read the DNA sequence, let’s say a random region of the DNA, it would be arranged slightly differently in each organism. For example, a 20-letters region somewhere in the vast expanse of DNA molecule might look like the following:
GCGTCCGAGGTAGACGATGG human
GCGTCCGAGGTAGACGATCG monkey
GCGTCCTTCCTAGACGATGG rice plant
This is just a hypothetical example and shows sequence variation in just a tiny 20-letters fragment of DNA in different organisms. Can you imagine how differently 3,200,000,000-letters long DNA can be arranged? Countless ways (your computer might crash if it starts guessing different combinations/arrangements of the four letters in 3.2billion-letters long DNA).
Similarly, the DNA sequence is altered in different disease conditions. For example, DNA from brain cells of healthy person versus brain tumour patient (hypothetical example) might look like this:
GCGTCCGAGGTAGACGATGG healthy person
GCGTCCGAGGTAGACGATGAG brain tumour patient
This extra ‘A’ in the brain tumour patient DNA might seem as a tiny error to human eye but it can change the behaviour of brain cells to divide continuously, giving rise to the tumour. Theoretically, if we can revert back the DNA sequence to its original healthy sequence, we can transform tumour cells to normal cells.
And that’s where CRISPR-Cas9 comes into the picture. Yes, it can perform this magic for us. The Cas9 protein (the molecular scissors) can be directed to this particular faulty part of the DNA, where it can cut the DNA, slice out the extra ‘A’, and then cellular machinery can re-join broken ends. The CRISPR Cas9-mediated gene-correction method can be used to virtually treat any disease. Similarly, suppose if we know, adding extra ‘GCTG’ to rice DNA could make it more nutritious or produce longer grains, we can do that using CRISPR-Cas9 method.
GCGTCCTTCCTAGACGATGG normal rice plant
GCGTCCTTCCTAGACGCTGGATGG rice plant with longer grains
Again, this is just a hypothetical example. Rice DNA is 3,000,0,000-letters long and many more changes in the DNA sequence would be required to produce longer-grain variety. Researchers around the world studying rice DNA will one day find out what changes in DNA sequence are required and then using CRISPR-Cas9, we can introduce those changes into rice DNA and relish delicious Hyderabadi Biryani .
At the molecular level, CRISPR-Cas9 system consists of the following components (donor DNA is optional and is needed when you want to make a specific change):
1. Cas9 enzyme: a protein that has the ability to cut/snip DNA. The first step in DNA sequence correction is making a double-stranded break (DSB) at the desired target site. Once a break is made, DNA repair proteins gather at the broken ends of DNA and ponder how to re-join the broke ends.
2. guide RNA: a small piece (20-letters) of RNA that tells Cas9 where to cut in the long DNA molecule. Therefore, guide RNA has the information about target DNA sequence. Guide RNA sequence is essentially similar to target DNA except for the fact that it has a different letter ‘U’ instead of ‘T’. For example,
GCGTCCGAGGTAGACGATGG DNA target sequence
GCGUCCGAGGUAGACGAUGG guide RNA sequence
As you might have guessed, CRISPR-Cas9 works as a Cas9/guide RNA complex, wherein guide RNA has the information about where to cut and Cas9 has the ability to cut. Scientists, express or deliver Cas9/guide RNA complex in the cells and deliberately make a cut at the faulty sites in the DNA.
3. donor DNA: The donor DNA has the corrected DNA sequence. The repair enzymes use donor DNA to re-join broken ends, and the end result is DNA sequence similar to desired ‘healthy’ DNA.
I hope you now have an idea of how Cas9/guide RNA scissors work. Of course, this is just a layman description of how it works and there are many intricate technological challenges that need to be addressed before we try CRISPR-Cas9 gene correction on humans. But we are making progress and not very far from doing ‘seemingly impossible things’ in all aspects of life around us using CRISPR-Cas9 magic !
While much of the scientific community was very busy optimising CRISPR-Cas9 technology for their affectionate model systems (mammalian cells, plants, organisms- mouse, zebrafish), a recent article in Nature Biotechnology has left everyone baffled.
The article was published online ahead of print in Nature Biotechnology journal last month, authored by Chunyu Han lab members from China. The authors demonstrate that a protein of Argonaute class can be utilised to edit genome using a DNA guide sequence. The enzyme belongs to the bacterium Natronobacterium gregoryi and has been christened as NgAgo (Natronobacterium gregoryi Argonaute). By the way, I like rhyming NgAgo with San Diego, so if you are writing a rap song about genome-editing, just give it a thought!
But, seriously, why so much buzz about an enzyme that is guided by a 24-nt DNA sequence rather than 20-nt RNA sequence as in CRISPR-Cas9 system?
Well, it appears that NgAgo system has many advantages over Cas9 system.
Before Cas9 supporters hit me , let me tell you that everything is not good about NgAgo and there are some Cas9 moments as well.
Will NgAgo overshadow CRISPR-Cas9?
Hold on guys, give it some time. NgAgo is just one article and a month old. It surely appears cost-effective and simpler but needs to be scrupulously tested head-to-head with Cas9 system. The biggest concern with NgAgo is the impossible task of expressing 5′ phosphorylated single-stranded guide DNA in cells. Cas9 guide RNA enjoys various methods of delivery: in vitro pre-assembly, plasmid-mediated co-expression, virus-mediated expression etc. But I am sure scientists will come up with better variants of NgAgo or who knows, altogether new class of guided-endoncleases!
We have come a long way- since the discovery of DNA as the genetic material to mapping of the human genome (3,200,000,000-letters) and now to editing any letter in the human genome. The last 10 years have seen so much progress in the field of genome-editing. The RNA guide-based system, CRISPR-Cas9, has revolutionised genome-editing area and made us more ambitious to target many more genes and organisms in less time and money. Future studies will unleash the potential of NgAgo system and show whether it can overtake powerful CRISPR-Cas9.
Want to know how scientists edit (cut some part, paste something new) the blueprint of life- DNA?
Well, you are at the right place. This blog is all about DNA molecules in each of our cells (except red blood cells, these guys live without DNA!) and how molecular biologists alter a little information in long piece of DNA to make life better.
This might take some weeks to fill in more information, so please bear up with the delay and visit again.